Hulk Hallie Litecoin Game Dog - Mix of Border Collie, Labrador, Dachshund, Husky, Labrador BK, Grey Wolf and Rottweiler
Hulk Hallie
  • Purity 14%
  • Age 12 months
  • Racing Exp 0
  • Border Collie 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Sad & Tardy

Achievements

None

Bio

Slipping my collar, running off and making my humans worried? Every chance I get. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACGGATACCCACCAACATACGCACCCCAC
T
A
C
T
A
C
G
G
A
T
A
C
C
C
A
C
C
A
A
C
A
T
A
C
G
C
A
C
C
C
C
A
C
Genes: JJAJ554J6LH

Composition

Border Collie
36%
Labrador
18%
Dachshund
9%
Husky
9%
Labrador BK
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -34 points
Lunar Effect +8 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Labrador
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes Grey Wolf
Color Rottweiler