Mulan Marshmallow Crypto Dog - Mix of German Shepard, Husky, Beagle, Rottweiler, Labrador and Maltese
Mulan Marshmallow
  • Purity 29%
  • Age 6 months
  • Racing Exp 0
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

Pleased to meet you! My name's Mulan Marshmallow. I live in your digital dreams. I'll outrun you for the ball if I can...that's just how I roll. I enjoy staying active, and running circles around puppies and young children. Fun-loving and playful only need apply.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCATCATCATCACTACACCCATCATCAACC
A
C
A
T
C
A
T
C
A
T
C
A
T
C
A
C
T
A
C
A
C
C
C
A
T
C
A
T
C
A
A
C
C
Genes: 47777DH577K

Composition

German Shepard
55%
Husky
9%
Beagle
9%
Rottweiler
9%
Labrador
9%
Maltese
9%

Current Energy

Vitality -7 points
Lunar Effect +18 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Beagle
Snout Rottweiler
Mouth Labrador
Nose German Shepard
Eyes German Shepard
Color Maltese