Kyra Kiva Cryptocurrency Dog - Mix of Husky, Golder Retriever, Pitbull terrier and Shiba Inu
Kyra Kiva
  • Purity 53%
  • Age 18 months
  • Racing Exp 7
  • Husky 73%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 10
Sad & Tardy

Achievements

Racer

Bio

Yo! I'm Kyra Kiva and I'd like to rock your world. Removing excess stuffing from pillows is my favorite hobby. I'll outrun you for the ball if I can...that's just how I roll. Aggressive dogs that don't let 'me be me' frustrate me. When I can break free, I enjoy exploring my neighborhood without my human.

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.23 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACAAGATCCGTAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
A
G
A
T
C
C
G
T
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 4448NE44444

Composition

Husky
73%
Golder Retriever
9%
Pitbull terrier
9%
Shiba Inu
9%

Current Energy

Vitality -6 points
Lunar Effect +18 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears Shiba Inu
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky