Fourth Down Fonzie Litecoin Dog - Mix of Golder Retriever, Husky and German Shepard
Fourth Down Fonzie
  • Purity 32%
  • Age 6 months
  • Racing Exp 7
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

My name is Fourth Down Fonzie and I'd really like to sniff you. Nyan Cat is my best friend here in the cyberspace. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.35 sec
No rank  RacingĀ *** LTC
100.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAAGAAGATCATCAAGAAGATCAAGAACAACA
A
C
A
A
G
A
A
G
A
T
C
A
T
C
A
A
G
A
A
G
A
T
C
A
A
G
A
A
C
A
A
C
A
Genes: 48877887844

Composition

Golder Retriever
45%
Husky
27%
German Shepard
27%

Current Energy

Vitality -2 points
Lunar Effect +8 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Golder Retriever
Front Legs German Shepard
Head German Shepard
Ears Golder Retriever
Snout Golder Retriever
Mouth German Shepard
Nose Golder Retriever
Eyes Husky
Color Husky

Parents

No Children

Photos

online doggy racing results
Gift