Winnie the Poodle Whiskers Litecoin Game Dog - Mix of Border Collie, French Bulldog, Labrador, Beagle, Poodle, Schnauzer, Shiba Inu and Rottweiler
Winnie the Poodle Whiskers
  • Purity 4%
  • Age 6 months
  • Racing Exp 1
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

Hi, I'm Winnie the Poodle Whiskers. I enjoy mixing it up once in a while by visiting different dog parks. I hate having to wear foo-foo clothes and ribbons in my fur. I slept with a cat and I liked it. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I'm looking for some ruff play. Wanna bite me?

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.62 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATACGACATACGACCAGTACCACACTACCGA
C
T
A
T
A
C
G
A
C
A
T
A
C
G
A
C
C
A
G
T
A
C
C
A
C
A
C
T
A
C
C
G
A
Genes: DJIC95E5HJ9

Composition

Border Collie
18%
French Bulldog
18%
Labrador
18%
Beagle
9%
Poodle
9%
Schnauzer
9%
Shiba Inu
9%
Rottweiler
9%

Current Energy

Vitality -50 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Poodle
Front Legs Schnauzer
Head French Bulldog
Ears Labrador
Snout Shiba Inu
Mouth Labrador
Nose Rottweiler
Eyes Border Collie
Color French Bulldog