Brittany Buzz Crypto Dog - Mix of Border Collie, Schnauzer, French Bulldog, Beagle, Labrador, Corgi, Pitbull terrier and Dachshund
Brittany Buzz
  • Purity 6%
  • Age 6 months
  • Racing Exp 1
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

My favorite sport is catching treats my human throws! I like nibbling on most everything, but I'll bite if you want me to. I hate bubble baths; mud puddles are more my style. Those flying monkeys in the Wizard of Oz still scare me! I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.77 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATACATAATACGACCAAGCTCCGGATACCGA
C
T
A
T
A
C
A
T
A
A
T
A
C
G
A
C
C
A
A
G
C
T
C
C
G
G
A
T
A
C
C
G
A
Genes: DJCC95ONAJ9

Composition

Border Collie
18%
Schnauzer
18%
French Bulldog
18%
Beagle
9%
Labrador
9%
Corgi
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -55 points
Lunar Effect -2 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Schnauzer
Front Legs Schnauzer
Head French Bulldog
Ears Labrador
Snout Corgi
Mouth Pitbull terrier
Nose Dachshund
Eyes Border Collie
Color French Bulldog