Lexi Lucifer Bitcoin Dog - Mix of Border Collie, Dachshund, Grey Wolf, Boxer, Golder Retriever, German Shepard and Schnauzer
Lexi Lucifer
  • Purity 18%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Hola! My name is Lexi Lucifer. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. The absolute best time of day is dinner time! I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Just looking to sow some wild oats here...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACGGACCCTACTACAACAGATACTCAATATAC
T
A
C
G
G
A
C
C
C
T
A
C
T
A
C
A
A
C
A
G
A
T
A
C
T
C
A
A
T
A
T
A
C
Genes: JALJJG8J7CJ

Composition

Border Collie
45%
Dachshund
9%
Grey Wolf
9%
Boxer
9%
Golder Retriever
9%
German Shepard
9%
Schnauzer
9%

Current Energy

Vitality -2 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Dachshund
Legs Grey Wolf
Front Legs Border Collie
Head Border Collie
Ears Boxer
Snout Golder Retriever
Mouth Border Collie
Nose German Shepard
Eyes Schnauzer
Color Border Collie