Samson Sally Crypto Dog - Mix of Boxer, Pug, Labrador, Golder Retriever, Rottweiler, St. Bernard, Labrador BK and Dachshund
Samson Sally
  • Purity 8%
  • Age 13 months
  • Racing Exp 1
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Hola! My name is Samson Sally. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I'd like to help you shed your coat, baby.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.77 sec
Rank 86  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCAAGAAACCACAACGAAGAAAACTGAGCAGGA
C
C
A
A
G
A
A
A
C
C
A
C
A
A
C
G
A
A
G
A
A
A
A
C
T
G
A
G
C
A
G
G
A
Genes: 58GHG22GB6A

Composition

Boxer
27%
Pug
18%
Labrador
9%
Golder Retriever
9%
Rottweiler
9%
St. Bernard
9%
Labrador BK
9%
Dachshund
9%

Current Energy

Vitality -33 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador
Tail Golder Retriever
Legs Boxer
Front Legs Rottweiler
Head Boxer
Ears Pug
Snout Pug
Mouth Boxer
Nose St. Bernard
Eyes Labrador BK
Color Dachshund

Parents

No Children

Photos

Gift