Tuesday Toots Litecoin Game Dog - Mix of Golder Retriever, St. Bernard, Border Collie, Pitbull terrier and Husky
Tuesday Toots
  • Purity 31%
  • Age 4 months
  • Racing Exp 1
  • Golder Retriever 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 10
Depressed & Snaillike

Achievements

Racer

Bio

Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I'll eat my vomit and yours too. I love unconditionally.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.97 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACAGAAGATCCTGAAGAAGAAGAAGAACATGA
T
A
C
A
G
A
A
G
A
T
C
C
T
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
C
A
T
G
A
Genes: J88NB88884B

Composition

Golder Retriever
55%
St. Bernard
18%
Border Collie
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -26 points
Lunar Effect +10 points

Traits Breakdown

Body Border Collie
Tail Golder Retriever
Legs Golder Retriever
Front Legs Pitbull terrier
Head St. Bernard
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Husky
Color St. Bernard

Parents

No Children

Photos

Gift