Buster Buddie Digital Cryptocurrency Dog - Mix of Schnauzer, Dachshund, Pug, Boxer, Labrador BK, Labrador, Corgi, Pitbull terrier and Husky
Buster Buddie
  • Purity 5%
  • Age 6 months
  • Racing Exp 0
  • Schnauzer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

They call me Buster Buddie. What's your name? Removing excess stuffing from pillows is my favorite hobby. My bark alone scares birds out of my yard. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! Just looking to sow some wild oats here...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GAAAACATAATAGCACCAAGCTCCGGAACAGGA
G
A
A
A
A
C
A
T
A
A
T
A
G
C
A
C
C
A
A
G
C
T
C
C
G
G
A
A
C
A
G
G
A
Genes: 2GCC65ONA4A

Composition

Schnauzer
18%
Dachshund
18%
Pug
9%
Boxer
9%
Labrador BK
9%
Labrador
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -65 points
Lunar Effect -2 points

Traits Breakdown

Body Pug
Tail Boxer
Legs Schnauzer
Front Legs Schnauzer
Head Labrador BK
Ears Labrador
Snout Corgi
Mouth Pitbull terrier
Nose Dachshund
Eyes Husky
Color Dachshund