Baron Buffy Litecoin Dog - Mix of Schnauzer, German Shepard, Golder Retriever and Dachshund
Baron Buffy
  • Purity 29%
  • Age 18 months
  • Racing Exp 0
  • Schnauzer 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 10
Sad & Tardy

Achievements

None

Bio

My favorite position is doggie style ;) Size doesn't matter, I like 'em all. I'll outrun you for the ball if I can...that's just how I roll. Aggressive dogs that don't let 'me be me' frustrate me.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATCAATAATATCATCAATAATAGGATCAATA
A
G
A
T
C
A
A
T
A
A
T
A
T
C
A
T
C
A
A
T
A
A
T
A
G
G
A
T
C
A
A
T
A
Genes: 87CC77CCA7C

Composition

Schnauzer
45%
German Shepard
36%
Golder Retriever
9%
Dachshund
9%

Current Energy

Vitality -51 points
Lunar Effect +12 points

Traits Breakdown

Body Golder Retriever
Tail German Shepard
Legs Schnauzer
Front Legs Schnauzer
Head German Shepard
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes German Shepard
Color Schnauzer