Ming Megan Cryptocurrency Dog - Mix of Golder Retriever, Husky, Schnauzer, Labrador BK and Pitbull terrier
Ming Megan
  • Purity 26%
  • Age 18 months
  • Racing Exp 0
  • Golder Retriever 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Sad & Tardy

Achievements

None

Bio

I answer to 'Ming Megan'. I am a guard dog for the data warehouse. I like giving wet kisses. If you have fleas or ticks, don't bother. Sometimes I just have to roll in something dead. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAAGAAGAATAGCAAGAAGATCCAGAACAACA
A
C
A
A
G
A
A
G
A
A
T
A
G
C
A
A
G
A
A
G
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 488C688N844

Composition

Golder Retriever
45%
Husky
27%
Schnauzer
9%
Labrador BK
9%
Pitbull terrier
9%

Current Energy

Vitality -32 points
Lunar Effect +12 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Golder Retriever
Front Legs Schnauzer
Head Labrador BK
Ears Golder Retriever
Snout Golder Retriever
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky