Dreamer Dobby Bitcoin Dog - Mix of German Shepard and Husky
Dreamer Dobby
  • Purity 54%
  • Age 9 months
  • Racing Exp 1
  • German Shepard 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

Have you ever dated a digital creation before? I don't like having to stay off the furniture. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I'm not looking to hook up forever, just to have a little fun.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.52 sec
Rank 61  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCAACATCAACATCATCATCAACA
T
C
A
T
C
A
T
C
A
T
C
A
A
C
A
T
C
A
A
C
A
T
C
A
T
C
A
T
C
A
A
C
A
Genes: 77774747774

Composition

German Shepard
73%
Husky
27%

Current Energy

Vitality -7 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head Husky
Ears German Shepard
Snout Husky
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Husky