Donald Trump Dawson Bitcoin Dog - Mix of St. Bernard, German Shepard, Border Collie, Labrador and Boxer
Donald Trump Dawson
  • Purity 16%
  • Age 9 months
  • Racing Exp 0
  • St. Bernard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 11
Depressed & Snaillike

Achievements

None

Bio

I love cuddling up, doggy-style after a romantic evening. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. You know the worst? Watching my humans 'get it on' and I have to lick myself. I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTGATACTCATGACCATGAAACTCATCATGA
T
A
C
T
G
A
T
A
C
T
C
A
T
G
A
C
C
A
T
G
A
A
A
C
T
C
A
T
C
A
T
G
A
Genes: JBJ7B5BG77B

Composition

St. Bernard
36%
German Shepard
27%
Border Collie
18%
Labrador
9%
Boxer
9%

Current Energy

Vitality -16 points
Lunar Effect +10 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs German Shepard
Head St. Bernard
Ears Labrador
Snout St. Bernard
Mouth Boxer
Nose German Shepard
Eyes German Shepard
Color St. Bernard