Koko Kabal Crypto Dog - Mix of St. Bernard, Border Collie, Pitbull terrier, Maltese and Boxer
Koko Kabal
  • Purity 15%
  • Age 18 months
  • Racing Exp 0
  • St. Bernard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Tardy

Achievements

None

Bio

Pleased to meet you! My name's Koko Kabal. I live behind a firewall in the Machine. Hound Dog by Elvis is probably the best song ever written. I like to respond to sad puppy eyes with sad puppy eyes of my own. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTGATACTCCTGAACCTGAAACTCCTACTGA
T
A
C
T
G
A
T
A
C
T
C
C
T
G
A
A
C
C
T
G
A
A
A
C
T
C
C
T
A
C
T
G
A
Genes: JBJNBKBGNJB

Composition

St. Bernard
36%
Border Collie
27%
Pitbull terrier
18%
Maltese
9%
Boxer
9%

Current Energy

Vitality -17 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs Pitbull terrier
Head St. Bernard
Ears Maltese
Snout St. Bernard
Mouth Boxer
Nose Pitbull terrier
Eyes Border Collie
Color St. Bernard