Ferrari Fresier Digital Cryptocurrency Dog - Mix of German Shepard, Boxer, Labrador, Pug, Pitbull terrier and Maltese
Ferrari Fresier
  • Purity 27%
  • Age 16 months
  • Racing Exp 0
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 10
Neutral & Casual

Achievements

None

Bio

I live inside of a Virtual machine two steps to the right from the firewall. I'm always up for some puppy action, is that wrong? I hate having to share my food dish... I love cuddling up, doggy-style after a romantic evening. If you are looking for companionship without commitment, so am I.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCAAACTCATCATCACCAGAATCCTCATCAACC
T
C
A
A
A
C
T
C
A
T
C
A
T
C
A
C
C
A
G
A
A
T
C
C
T
C
A
T
C
A
A
C
C
Genes: 7G77752N77K

Composition

German Shepard
55%
Boxer
9%
Labrador
9%
Pug
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -5 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Boxer
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Labrador
Snout Pug
Mouth Pitbull terrier
Nose German Shepard
Eyes German Shepard
Color Maltese