Mouse Murphy Litecoin Dog - Mix of St. Bernard, German Shepard, Schnauzer, Maltese, Labrador and Labrador BK
Mouse Murphy
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • St. Bernard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

Yo! I'm Mouse Murphy and I'd like to rock your world. When I hook up, I stay hooked up for about 20 minutes. Creativity is my middle name... I turn everything in to a chew toy. I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCAACCTGAATATGACCAATAGCATGA
T
C
A
T
G
A
T
C
A
A
C
C
T
G
A
A
T
A
T
G
A
C
C
A
A
T
A
G
C
A
T
G
A
Genes: 7B7KBCB5C6B

Composition

St. Bernard
36%
German Shepard
18%
Schnauzer
18%
Maltese
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -30 points
Lunar Effect +12 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Maltese
Head St. Bernard
Ears Schnauzer
Snout St. Bernard
Mouth Labrador
Nose Schnauzer
Eyes Labrador BK
Color St. Bernard