Dudley Daffy Bitcoin Dog - Pure German Shepard
Dudley Daffy
  • Purity 100%
  • Age 5 months
  • Racing Exp 14
  • German Shepard 100%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 3 races
  • Gen 10
Depressed & Snaillike

Achievements

First Pure Breed Dog
Racer

Bio

I live in your digital dreams. I'm the best at running circle 8's. My favorite chews are underwear and rawhide...the rawhide lasts longer. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!

Racing Stats

Ran 3 races
  • 0 1 1
 Best Time15.50 sec
No rank  RacingĀ *** LTC
66.7 % wins (2) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard