Spark Sparkplug Cryptocurrency Dog - Mix of German Shepard and Shiba Inu
Spark Sparkplug
  • Purity 82%
  • Age 3 months
  • Racing Exp 3
  • German Shepard 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 9
Depressed & Snaillike

Achievements

Racer

Bio

What's up, pup? Name's Spark Sparkplug. I'm into group dog piles, the more the better. I don't like going to the groomer. Leave my beautiful fur alone! I like it when you're frisky. I live life by my favorite quote "Every dog has it's day", but every day is my day!

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time14.17 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCAGTA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
T
A
Genes: 7777777777E

Composition

German Shepard
91%
Shiba Inu
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Shiba Inu