Mila Monster Cryptocurrency Dog - Mix of German Shepard, Boxer and Dachshund
Mila Monster
  • Purity 65%
  • Age 12 months
  • Racing Exp 0
  • German Shepard 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Sad & Tardy

Achievements

None

Bio

I believe running along the beach to catch a stick can be nearly orgasmic. I like it when you're frisky. I cry whenever I hear an ambulance siren! I don't appreciate being around bores who bark too much.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCAAACTCATCATCATCATCAGGA
T
C
A
T
C
A
T
C
A
T
C
A
A
A
C
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
G
A
Genes: 7777G77777A

Composition

German Shepard
82%
Boxer
9%
Dachshund
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head Boxer
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Dachshund