Cherokee Czar Litecoin Game Dog - Mix of German Shepard, Dachshund and Husky
Cherokee Czar
  • Purity 51%
  • Age 14 months
  • Racing Exp 0
  • German Shepard 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Neutral & Lazy

Achievements

None

Bio

Hi, Cherokee Czar is my name. Baby, I'm made from the same stuff as dreams. I don't like going to the groomer. Leave my beautiful fur alone! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Getting out of a long relationship, not looking for another

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATCATCATCAACATCAGGATCATCATCAGGA
T
C
A
T
C
A
T
C
A
T
C
A
A
C
A
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
G
G
A
Genes: 777747A777A

Composition

German Shepard
73%
Dachshund
18%
Husky
9%

Current Energy

Vitality -7 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head Husky
Ears German Shepard
Snout Dachshund
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Dachshund