Butchy Bianca Crypto Dog - Mix of German Shepard, Husky, Border Collie and Yorkshire Terrier
Butchy Bianca
  • Purity 37%
  • Age 5 months
  • Racing Exp 0
  • German Shepard 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 6
Depressed & Snaillike

Achievements

None

Bio

Hola! My name is Butchy Bianca. I was born in the web cloud. My favorite position is doggie style ;) I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I slept with a cat and I liked it. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATACTCATCAACATCAACATCATCATCATTA
T
C
A
T
A
C
T
C
A
T
C
A
A
C
A
T
C
A
A
C
A
T
C
A
T
C
A
T
C
A
T
T
A
Genes: 7J77474777F

Composition

German Shepard
64%
Husky
18%
Border Collie
9%
Yorkshire Terrier
9%

Current Energy

Vitality -10 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Border Collie
Legs German Shepard
Front Legs German Shepard
Head Husky
Ears German Shepard
Snout Husky
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Yorkshire Terrier