Zoe Zoe Bitcoin Dog - Mix of German Shepard, St. Bernard, Grey Wolf and Husky
Zoe Zoe
  • Purity 30%
  • Age 4 months
  • Racing Exp 1
  • German Shepard 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

Suh? How's it goin? I'm Zoe Zoe. I enjoy exploration and am game for anything doggy-style. The place I like most in the world is curled up in my human's bed, hogging all the covers! My turn-offs are rolled up newspapers and loud noises. I adore sleeping upside down with my tongue hanging out!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.15 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCACCCACATCATGATCATCATCATGA
T
C
A
T
G
A
T
C
A
C
C
C
A
C
A
T
C
A
T
G
A
T
C
A
T
C
A
T
C
A
T
G
A
Genes: 7B7L47B777B

Composition

German Shepard
55%
St. Bernard
27%
Grey Wolf
9%
Husky
9%

Current Energy

Vitality -11 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Grey Wolf
Head Husky
Ears German Shepard
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color St. Bernard