Southpaw Spark Bitcoin Game Dog - Mix of German Shepard, St. Bernard, Grey Wolf and Border Collie
Southpaw Spark
  • Purity 27%
  • Age 16 months
  • Racing Exp 0
  • German Shepard 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Neutral & Casual

Achievements

None

Bio

How you doin? ;) Southpaw Spark here. I am a guard dog for the data warehouse. The place I like most in the world is curled up in my human's bed, hogging all the covers! I'm always up for some puppy action, is that wrong? I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TCATGATCACCCTGATACTGATCATCATCATGA
T
C
A
T
G
A
T
C
A
C
C
C
T
G
A
T
A
C
T
G
A
T
C
A
T
C
A
T
C
A
T
G
A
Genes: 7B7LBJB777B

Composition

German Shepard
45%
St. Bernard
36%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -10 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail St. Bernard
Legs German Shepard
Front Legs Grey Wolf
Head St. Bernard
Ears Border Collie
Snout St. Bernard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color St. Bernard