Zorro Zilch Bitcoin Dog - Mix of Schnauzer, Labrador BK, Golder Retriever, Corgi, Grey Wolf, Shiba Inu, German Shepard, Pug and Pitbull terrier
Zorro Zilch
  • Purity 5%
  • Age 11 months
  • Racing Exp 0
  • Schnauzer 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

I'm Zorro Zilch. What do they call you? Sometimes I forget where I buried my bone. After introductory sniffing, I like some licking. What's your favorite bed? Mine is the dirty laundry. I don't like going to the groomer. Leave my beautiful fur alone! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAATAAGAAGCCCCGCAGTATCAGAAGCATCC
A
T
A
A
T
A
A
G
A
A
G
C
C
C
C
G
C
A
G
T
A
T
C
A
G
A
A
G
C
A
T
C
C
Genes: CC8OL6E726N

Composition

Schnauzer
18%
Labrador BK
18%
Golder Retriever
9%
Corgi
9%
Grey Wolf
9%
Shiba Inu
9%
German Shepard
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality -39 points
Lunar Effect +4 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Golder Retriever
Front Legs Corgi
Head Grey Wolf
Ears Labrador BK
Snout Shiba Inu
Mouth German Shepard
Nose Pug
Eyes Labrador BK
Color Pitbull terrier

Parents

No Children

Gift