Pasha Puffy Digital Cryptocurrency Dog - Mix of St. Bernard, Shiba Inu, Border Collie, German Shepard, Beagle and Rottweiler
Pasha Puffy
  • Purity 15%
  • Age 5 months
  • Racing Exp 0
  • St. Bernard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Pasha Puffy here. Wanna play? Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. I hate it when my humans fart and they blame me! Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTGATCAGTATGACTATGAGTAGTACACTGA
T
A
C
T
G
A
T
C
A
G
T
A
T
G
A
C
T
A
T
G
A
G
T
A
G
T
A
C
A
C
T
G
A
Genes: JB7EBDBEEHB

Composition

St. Bernard
36%
Shiba Inu
27%
Border Collie
9%
German Shepard
9%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality -26 points
Lunar Effect +10 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs German Shepard
Front Legs Shiba Inu
Head St. Bernard
Ears Beagle
Snout St. Bernard
Mouth Shiba Inu
Nose Shiba Inu
Eyes Rottweiler
Color St. Bernard