Hamlet Helmet Litecoin Dog - Mix of St. Bernard, German Shepard, Pitbull terrier, Border Collie, Maltese and Shiba Inu
Hamlet Helmet
  • Purity 12%
  • Age 6 months
  • Racing Exp 2
  • St. Bernard 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

As a good digital dog, my humans give me virtually everything. I hate it when humans put the lid down. Spiked dog collars really turn me on. I am a proud show dog. I like showing off my perfect coat! Little Bow Wow is my favorite musician. I just assume he's a dog...

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time15.32 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTGATCATCCTGAACCTGAGTATCCTCATGA
T
A
C
T
G
A
T
C
A
T
C
C
T
G
A
A
C
C
T
G
A
G
T
A
T
C
C
T
C
A
T
G
A
Genes: JB7NBKBEN7B

Composition

St. Bernard
36%
German Shepard
18%
Pitbull terrier
18%
Border Collie
9%
Maltese
9%
Shiba Inu
9%

Current Energy

Vitality -31 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs German Shepard
Front Legs Pitbull terrier
Head St. Bernard
Ears Maltese
Snout St. Bernard
Mouth Shiba Inu
Nose Pitbull terrier
Eyes German Shepard
Color St. Bernard