Mister Mac Crypto Game Dog - Mix of Shiba Inu, Beagle, Husky, Rottweiler, French Bulldog and Pitbull terrier
Mister Mac
  • Purity 12%
  • Age 18 months
  • Racing Exp 0
  • Shiba Inu 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Happy & Quick

Achievements

None

Bio

Hullo. My name is Mister Mac. I love car rides when I can stick my head out the window. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTACGAACAGTAGTACTAACATCCGTACACCAC
C
T
A
C
G
A
A
C
A
G
T
A
G
T
A
C
T
A
A
C
A
T
C
C
G
T
A
C
A
C
C
A
C
Genes: D94EED4NEHH

Composition

Shiba Inu
27%
Beagle
18%
Husky
18%
Rottweiler
18%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail French Bulldog
Legs Husky
Front Legs Shiba Inu
Head Shiba Inu
Ears Beagle
Snout Husky
Mouth Pitbull terrier
Nose Shiba Inu
Eyes Rottweiler
Color Rottweiler