Pasha Pearl Digital Cryptocurrency Game Dog - Mix of Border Collie, French Bulldog, Boxer, Beagle, Rottweiler and Corgi
Pasha Pearl
  • Purity 12%
  • Age 6 months
  • Racing Exp 10
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 5 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Pasha Pearl is the name, love is my game. And fetch of course... Once I caught a seagull, but it scared me so I let it go. I hate hiding under the bed during a thunder storm but that's just smart, right? I'm looking for a hard-working service animal who can keep up with me.

Racing Stats

Ran 5 races
  • 0 0 1
 Best Time14.35 sec
No rank  RacingĀ *** LTC
20.0 % wins (1) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTATACTACCACCGAAACAGCAACCGATACCGA
C
T
A
T
A
C
T
A
C
C
A
C
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
A
C
C
G
A
Genes: DJJH9GOG9J9

Composition

Border Collie
27%
French Bulldog
27%
Boxer
18%
Beagle
9%
Rottweiler
9%
Corgi
9%

Current Energy

Vitality -25 points
Lunar Effect -6 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Border Collie
Front Legs Rottweiler
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes Border Collie
Color French Bulldog