Ebony Emmitt Litecoin Dog - Mix of Husky and French Bulldog
Ebony Emmitt
  • Purity 82%
  • Age 3 months
  • Racing Exp 0
  • Husky 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Depressed & Snaillike

Achievements

None

Bio

Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. My favorite game is Fetch except I never bring the ball back. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! My humans say I bark too much, but I have a lot to say!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACAACAACAACAACAACACGAACAACA
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
C
G
A
A
C
A
A
C
A
Genes: 44444444944

Composition

Husky
91%
French Bulldog
9%

Current Energy

Vitality -6 points
Lunar Effect +22 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Husky
Head Husky
Ears Husky
Snout Husky
Mouth Husky
Nose French Bulldog
Eyes Husky
Color Husky