Mack Max Payne Crypto Dog - Mix of Husky, Labrador BK, Dachshund and Rottweiler
Mack Max Payne
  • Purity 52%
  • Age 9 months
  • Racing Exp 1
  • Husky 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

I live in cyberspace where you can turn me on. I am on a mission to sniff all the butts in the world. ALL the butts. I don't like having to stay off the furniture. I believe running along the beach to catch a stick can be nearly orgasmic. You scratch my belly and I'll scratch yours ;)

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time15.90 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACAACAGCAGGAACAACACACACAACA
A
C
A
A
C
A
A
C
A
A
C
A
G
C
A
G
G
A
A
C
A
A
C
A
C
A
C
A
C
A
A
C
A
Genes: 44446A44H44

Composition

Husky
73%
Labrador BK
9%
Dachshund
9%
Rottweiler
9%

Current Energy

Vitality -4 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Husky
Head Labrador BK
Ears Dachshund
Snout Husky
Mouth Husky
Nose Rottweiler
Eyes Husky
Color Husky