Shamus Scoobie Litecoin Dog - Mix of Pug, Yorkshire Terrier, Shiba Inu, Boxer, Labrador, Corgi, Schnauzer and French Bulldog
Shamus Scoobie
  • Purity 8%
  • Age 16 months
  • Racing Exp 0
  • Pug 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

How you doin? ;) Shamus Scoobie here. I enjoy destroying a nice fresh pair of slippers. I absolutely love long walks when I can stop and smell the bushes. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
Rank 37  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAAACGAACCAAGCATATTAGAAGAATTACGA
G
T
A
A
A
C
G
A
A
C
C
A
A
G
C
A
T
A
T
T
A
G
A
A
G
A
A
T
T
A
C
G
A
Genes: EG25OCF22F9

Composition

Pug
27%
Yorkshire Terrier
18%
Shiba Inu
9%
Boxer
9%
Labrador
9%
Corgi
9%
Schnauzer
9%
French Bulldog
9%

Current Energy

Vitality -48 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Boxer
Legs Pug
Front Legs Labrador
Head Corgi
Ears Schnauzer
Snout Yorkshire Terrier
Mouth Pug
Nose Pug
Eyes Yorkshire Terrier
Color French Bulldog

Parents

No Children

Gift