Emo Ebony Cryptocurrency Game Dog - Mix of Husky, Rottweiler, Labrador BK and Dachshund
Emo Ebony
  • Purity 41%
  • Age 12 months
  • Racing Exp 0
  • Husky 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Sad & Tardy

Achievements

None

Bio

Who's a good dog? Hopefully you! Emo Ebony here. You know the worst? Watching my humans 'get it on' when I've got no one. My favorite way to spend playtime is a good game of frisbee. If you are looking for companionship without commitment, keep looking.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACACACGCAGGAACAACACACACAACA
A
C
A
A
C
A
A
C
A
C
A
C
G
C
A
G
G
A
A
C
A
A
C
A
C
A
C
A
C
A
A
C
A
Genes: 444H6A44H44

Composition

Husky
64%
Rottweiler
18%
Labrador BK
9%
Dachshund
9%

Current Energy

Vitality -15 points
Lunar Effect +6 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Rottweiler
Head Labrador BK
Ears Dachshund
Snout Husky
Mouth Husky
Nose Rottweiler
Eyes Husky
Color Husky