Ashley Armanti Litecoin Dog - Mix of Husky, Grey Wolf, Labrador BK, Border Collie and Maltese
Ashley Armanti
  • Purity 31%
  • Age 5 months
  • Racing Exp 0
  • Husky 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

If I can't reach it to clean it myself, it doesn't need cleaning! I enjoy destroying a nice fresh pair of slippers. I'm not a fan of sleeping on the floor. This body was made for cuddles! My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I just want to "share a bone"... ;)

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAACAACACCCGCATACACACCCACCACAACA
A
C
A
A
C
A
A
C
A
C
C
C
G
C
A
T
A
C
A
C
A
C
C
C
A
C
C
A
C
A
A
C
A
Genes: 444L6J4LK44

Composition

Husky
55%
Grey Wolf
18%
Labrador BK
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality -10 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Grey Wolf
Head Labrador BK
Ears Border Collie
Snout Husky
Mouth Grey Wolf
Nose Maltese
Eyes Husky
Color Husky