Blossom Blackie Litecoin Dog - Mix of Labrador BK, Pitbull terrier, Dachshund, Golder Retriever, Shiba Inu and Beagle
Blossom Blackie
  • Purity 14%
  • Age 12 months
  • Racing Exp 4
  • Labrador BK 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

This dawg chases mice in a big data warehouse. I've always had a crush on Lassie. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I enjoy mixing it up once in a while by visiting different dog parks. My favorite pastime is playing tug-of-war with my human's underwear.

Racing Stats

Ran 4 races
  • 0 0 0
 Best Time15.33 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GCAGCAAGAGCAGTATCCCTAGGATCCTCCGGA
G
C
A
G
C
A
A
G
A
G
C
A
G
T
A
T
C
C
C
T
A
G
G
A
T
C
C
T
C
C
G
G
A
Genes: 6686ENDANNA

Composition

Labrador BK
27%
Pitbull terrier
27%
Dachshund
18%
Golder Retriever
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality -11 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Labrador BK
Legs Golder Retriever
Front Legs Labrador BK
Head Shiba Inu
Ears Pitbull terrier
Snout Beagle
Mouth Dachshund
Nose Pitbull terrier
Eyes Pitbull terrier
Color Dachshund

Parents

No Children

Photos

Gift