King Hippo Khaleesi Crypto Dog - Mix of Husky, Golder Retriever, Schnauzer, Labrador BK, Corgi and Pitbull terrier
King Hippo Khaleesi
  • Purity 20%
  • Age 3 months
  • Racing Exp 0
  • Husky 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 3
Depressed & Snaillike

Achievements

None

Bio

Suh? How's it goin? I'm King Hippo Khaleesi. I'm going kill that damn Nyan Cat if I can catch it. I hate hiding under the bed during a thunder storm but that's just smart, right? I'm the best at running circle 8's. Fun-loving and playful only need apply.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACAAGAACAATAGCAAGCACATCCAGAACAACA
A
C
A
A
G
A
A
C
A
A
T
A
G
C
A
A
G
C
A
C
A
T
C
C
A
G
A
A
C
A
A
C
A
Genes: 484C6O4N844

Composition

Husky
45%
Golder Retriever
18%
Schnauzer
9%
Labrador BK
9%
Corgi
9%
Pitbull terrier
9%

Current Energy

Vitality -30 points
Lunar Effect +16 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Husky
Front Legs Schnauzer
Head Labrador BK
Ears Corgi
Snout Husky
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Husky
Color Husky