Tramp Titus Litecoin Dog - Mix of Border Collie, German Shepard, Dachshund, Labrador, Husky, Labrador BK and Shiba Inu
Tramp Titus
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Border Collie 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Depressed & Snaillike

Achievements

None

Bio

I like it when you're frisky. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I've had my nose rubbed in 'it' more than once. I don't like to be ignored. I want to find that special friend who enjoys sharing each other's doggie bags.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTACGGATACTCACCAACATACGCATCAGTA
T
A
C
T
A
C
G
G
A
T
A
C
T
C
A
C
C
A
A
C
A
T
A
C
G
C
A
T
C
A
G
T
A
Genes: JJAJ754J67E

Composition

Border Collie
36%
German Shepard
18%
Dachshund
9%
Labrador
9%
Husky
9%
Labrador BK
9%
Shiba Inu
9%

Current Energy

Vitality -22 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head German Shepard
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes German Shepard
Color Shiba Inu