Doogie Diego Crypto Game Dog - Mix of Border Collie, German Shepard, Shiba Inu, Labrador, Husky, Labrador BK and Rottweiler
Doogie Diego
  • Purity 9%
  • Age 11 months
  • Racing Exp 0
  • Border Collie 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 6
Depressed & Snaillike

Achievements

None

Bio

Hey, Baby. I'm Doogie Diego. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I enjoy mixing it up once in a while by visiting different dog parks. When my human brushes my coat, I get frisky! I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: TACTCAGTATACTCACCAACATACGCATCACAC
T
A
C
T
C
A
G
T
A
T
A
C
T
C
A
C
C
A
A
C
A
T
A
C
G
C
A
T
C
A
C
A
C
Genes: J7EJ754J67H

Composition

Border Collie
27%
German Shepard
27%
Shiba Inu
9%
Labrador
9%
Husky
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -25 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Shiba Inu
Front Legs Border Collie
Head German Shepard
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes German Shepard
Color Rottweiler