Whiz Weaver Bitcoin Dog - Mix of German Shepard, Husky, Labrador, Shiba Inu, Beagle, Rottweiler and Pitbull terrier
Whiz Weaver
  • Purity 9%
  • Age 10 months
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 5
Depressed & Snaillike

Achievements

None

Bio

Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. My favorite position is doggie style ;) My 'G' spot is under my chin...scratch me there and I'll growl softly.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCAGTACCATCACTACACCCATCCTCAACA
A
C
A
T
C
A
G
T
A
C
C
A
T
C
A
C
T
A
C
A
C
C
C
A
T
C
C
T
C
A
A
C
A
Genes: 47E57DH5N74

Composition

German Shepard
27%
Husky
18%
Labrador
18%
Shiba Inu
9%
Beagle
9%
Rottweiler
9%
Pitbull terrier
9%

Current Energy

Vitality -21 points
Lunar Effect +12 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Shiba Inu
Front Legs Labrador
Head German Shepard
Ears Beagle
Snout Rottweiler
Mouth Labrador
Nose Pitbull terrier
Eyes German Shepard
Color Husky