Brook Bosley Bitcoin Dog - Mix of Golder Retriever, Grey Wolf, Yorkshire Terrier, Shiba Inu, Labrador, Poodle, Pug, Maltese, Beagle, French Bulldog and Rottweiler
Brook Bosley
  • Purity 0%
  • Age 6 months
  • Racing Exp 0
  • Mixed-breed
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

How YOU doin'? Brook Bosley here. Currently, I live on the information superhighway. I live life by my favorite quote "Every dog has it's day", but every day is my day! I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGACCCTTAGTACCAGACGAAACCCTACGACAC
A
G
A
C
C
C
T
T
A
G
T
A
C
C
A
G
A
C
G
A
A
A
C
C
C
T
A
C
G
A
C
A
C
Genes: 8LFE5I2KD9H

Composition

Golder Retriever
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Labrador
9%
Poodle
9%
Pug
9%
Maltese
9%
Beagle
9%
French Bulldog
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect -12 points

Traits Breakdown

Body Golder Retriever
Tail Grey Wolf
Legs Yorkshire Terrier
Front Legs Shiba Inu
Head Labrador
Ears Poodle
Snout Pug
Mouth Maltese
Nose Beagle
Eyes French Bulldog
Color Rottweiler

Parents

No Children

Gift