Gouken Greenie Litecoin Dog - Mix of Husky, Rottweiler, Beagle, Golder Retriever, Maltese, Corgi, Pitbull terrier, Yorkshire Terrier and German Shepard
Gouken Greenie
  • Purity 3%
  • Age 18 months
  • Racing Exp 4
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

It's a barkin' beautiful day! Gouken Greenie here. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I'm looking for a good Tug-O-War partner.

Racing Stats

Ran 4 races
  • 0 0 0
 Best Time15.55 sec
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CTAAGAACACACACCAGCACATCCTTATCACAC
C
T
A
A
G
A
A
C
A
C
A
C
A
C
C
A
G
C
A
C
A
T
C
C
T
T
A
T
C
A
C
A
C
Genes: D84HKO4NF7H

Composition

Husky
18%
Rottweiler
18%
Beagle
9%
Golder Retriever
9%
Maltese
9%
Corgi
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
German Shepard
9%

Current Energy

Vitality -45 points
Lunar Effect +2 points

Traits Breakdown

Body Beagle
Tail Golder Retriever
Legs Husky
Front Legs Rottweiler
Head Maltese
Ears Corgi
Snout Husky
Mouth Pitbull terrier
Nose Yorkshire Terrier
Eyes German Shepard
Color Rottweiler