Slobber-Knocker Stryker Cryptocurrency Game Dog - Mix of German Shepard, Grey Wolf, Rottweiler, Dachshund, French Bulldog and Schnauzer
Slobber-Knocker Stryker
  • Purity 15%
  • Age 5 months
  • Racing Exp 200
  • German Shepard 36%
  • Gold medal 9 Silver medal 11 Bronze medal 3
  • 56 races
  • Gen 2
Depressed & Snaillike

Achievements

Speed Champion
Podium Champion
Pro Racer
Master Champion

Bio

Hey there... I'm Slobber-Knocker Stryker. I need laid otherwise I'm going to start agreeing with Grumpy Cat. As a perfectionist, I have to find just the right 'spot'. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!

Racing Stats

Ran 56 races
  • 9 11 3
 Best Time13.55 sec
No rank  RacingĀ *** LTC
41.1 % wins (23) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCTCAGGACCCTCACACCACTCATCACGAATA
C
C
C
T
C
A
G
G
A
C
C
C
T
C
A
C
A
C
C
A
C
T
C
A
T
C
A
C
G
A
A
T
A
Genes: L7AL7HH779C

Composition

German Shepard
36%
Grey Wolf
18%
Rottweiler
18%
Dachshund
9%
French Bulldog
9%
Schnauzer
9%

Current Energy

Vitality -3 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Dachshund
Front Legs Grey Wolf
Head German Shepard
Ears Rottweiler
Snout Rottweiler
Mouth German Shepard
Nose German Shepard
Eyes French Bulldog
Color Schnauzer