Wally Wags Litecoin Dog - Mix of Grey Wolf, Shiba Inu, Rottweiler, German Shepard, Labrador, Yorkshire Terrier and Corgi
Wally Wags
  • Purity 11%
  • Age 3 months
  • Racing Exp 453
  • Grey Wolf 27%
  • Gold medal 18 Silver medal 31 Bronze medal 10
  • 91 races
  • Gen 1
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion
Speed Champion

Bio

I'm having some new data architecture built for me, then I'd like to have you over to my place. I like to work out by digging fresh holes in landscaped yards. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I just want to "share a bone"... ;)

Racing Stats

Ran 91 races
  • 18 31 10
 Best Time13.65 sec
No rank  RacingĀ *** LTC
64.8 % wins (59) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: CCCTCACCCCCCGTACACCACCCATTAAGCGTA
C
C
C
T
C
A
C
C
C
C
C
C
G
T
A
C
A
C
C
A
C
C
C
A
T
T
A
A
G
C
G
T
A
Genes: L7LLEHH5FOE

Composition

Grey Wolf
27%
Shiba Inu
18%
Rottweiler
18%
German Shepard
9%
Labrador
9%
Yorkshire Terrier
9%
Corgi
9%

Current Energy

Vitality -4 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Yorkshire Terrier
Eyes Corgi
Color Shiba Inu