Scooby Sindel Cryptocurrency Dog - Mix of German Shepard, Husky, Beagle, Shiba Inu, Maltese, Poodle and Pitbull terrier
Scooby Sindel
  • Purity 9%
  • Age 18 months
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Tardy

Achievements

None

Bio

Let me introduce myself, I'm Scooby Sindel. My AI may be artificial, but at least I'm intelligent. I enjoy destroying a nice fresh pair of slippers. I hate not being allowed to hunt treasure in the garbage. It smells so good! Rolling around on the carpet after a bath is my favorite way to dry.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACATCAGTAACCTCACTAGACCTATCCTCAACA
A
C
A
T
C
A
G
T
A
A
C
C
T
C
A
C
T
A
G
A
C
C
T
A
T
C
C
T
C
A
A
C
A
Genes: 47EK7DIDN74

Composition

German Shepard
27%
Husky
18%
Beagle
18%
Shiba Inu
9%
Maltese
9%
Poodle
9%
Pitbull terrier
9%

Current Energy

Vitality -43 points
Lunar Effect -2 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Shiba Inu
Front Legs Maltese
Head German Shepard
Ears Beagle
Snout Poodle
Mouth Beagle
Nose Pitbull terrier
Eyes German Shepard
Color Husky