Rambo Ryu Bitcoin Game Dog - Mix of Husky, Grey Wolf, Labrador, Pug, Rottweiler, Maltese, Dachshund, Golder Retriever and Boxer
Rambo Ryu
  • Purity 5%
  • Age 16 months
  • Racing Exp 0
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Neutral & Casual

Achievements

None

Bio

I am a guard dog for the data warehouse. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I believe running along the beach to catch a stick can be nearly orgasmic. You know the worst? Watching my humans 'get it on' when I've got no one.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ACACCCCCACCCGAACACACCGGAAGAAACACA
A
C
A
C
C
C
C
C
A
C
C
C
G
A
A
C
A
C
A
C
C
G
G
A
A
G
A
A
A
C
A
C
A
Genes: 4L5L2HKA8G4

Composition

Husky
18%
Grey Wolf
18%
Labrador
9%
Pug
9%
Rottweiler
9%
Maltese
9%
Dachshund
9%
Golder Retriever
9%
Boxer
9%

Current Energy

Vitality -8 points
Lunar Effect -10 points

Traits Breakdown

Body Husky
Tail Grey Wolf
Legs Labrador
Front Legs Grey Wolf
Head Pug
Ears Rottweiler
Snout Maltese
Mouth Dachshund
Nose Golder Retriever
Eyes Boxer
Color Husky