Ferris Fei Long Bitcoin Dog - Mix of Shiba Inu and Grey Wolf
Ferris Fei Long
  • Purity 82%
  • Age 4 months
  • Racing Exp 0
  • Shiba Inu 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 9
Depressed & Snaillike

Achievements

None

Bio

After introductory sniffing, I like some licking. I never knew my father. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: GTAGTAGTAGTAGTACCCGTAGTAGTAGTAGTA
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
C
C
C
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
Genes: EEEEELEEEEE

Composition

Shiba Inu
91%
Grey Wolf
9%

Current Energy

Vitality -44 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Grey Wolf
Snout Shiba Inu
Mouth Shiba Inu
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu