Queen Queen Crypto Game Dog - Mix of Schnauzer and German Shepard
Queen Queen
  • Purity 82%
  • Age 6 months
  • Racing Exp 0
  • Schnauzer 91%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 8
Depressed & Snaillike

Achievements

None

Bio

How goes it? I'm Queen Queen. The internet's my home. My favorite sport is catching treats my human throws! I enjoy destroying a nice fresh pair of slippers. I'm into leather...if I have the right partner. Long or short hair works for me, just no baldies please.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAATAATAATAATATCAATAATAATAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
C
A
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
Genes: CCCCC7CCCCC

Composition

Schnauzer
91%
German Shepard
9%

Current Energy

Vitality -68 points
Lunar Effect -18 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Schnauzer
Eyes Schnauzer
Color Schnauzer