Taki Toad Litecoin Dog - Mix of Schnauzer, Golder Retriever and Dachshund
Taki Toad
  • Purity 65%
  • Age 4 months
  • Racing Exp 0
  • Schnauzer 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 7
Depressed & Snaillike

Achievements

None

Bio

Here in cyberspace, I ain't got much use for a floppy disc. I hate it when I am not the center of attention. I never knew my father. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAATAATAATAATAAGAATAATAGGAATAATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
A
G
A
A
T
A
A
T
A
G
G
A
A
T
A
A
T
A
Genes: CCCCC8CCACC

Composition

Schnauzer
82%
Golder Retriever
9%
Dachshund
9%

Current Energy

Vitality -56 points
Lunar Effect +20 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Golder Retriever
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes Schnauzer
Color Schnauzer