Carla Clara Crypto Game Dog - Mix of Schnauzer, Yorkshire Terrier, Dachshund and Border Collie
Carla Clara
  • Purity 52%
  • Age 9 months
  • Racing Exp 0
  • Schnauzer 73%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 6
Depressed & Snaillike

Achievements

None

Bio

Whatcha know, honey. Carla Clara here. I live inside of a web app in a big data center. I don't understand why I like smelling butts... As a perfectionist, I have to find just the right 'spot'. My human's feet are definitely the greatest smell ever. Especially after a long day at work!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: ATAATAATAATAATATTAATAATAGGATACATA
A
T
A
A
T
A
A
T
A
A
T
A
A
T
A
T
T
A
A
T
A
A
T
A
G
G
A
T
A
C
A
T
A
Genes: CCCCCFCCAJC

Composition

Schnauzer
73%
Yorkshire Terrier
9%
Dachshund
9%
Border Collie
9%

Current Energy

Vitality -49 points
Lunar Effect +14 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes Border Collie
Color Schnauzer