Amy Aubree Litecoin Dog - Mix of Schnauzer, Yorkshire Terrier, Golder Retriever, Labrador and German Shepard
Amy Aubree
  • Purity 29%
  • Age 8 months
  • Racing Exp 0
  • Schnauzer 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Depressed & Snaillike

Achievements

None

Bio

What's up? I'm Amy Aubree. I like shaking my fur next to humans right after a good swim! I hate not being allowed to hunt treasure in the garbage. It smells so good! Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** LTC
0.0 % wins (0) Breeding *** LTC
Scheduled races 0 TotalĀ *** LTC

DNA Analysis

DNA Sequence: AGATTAATAATAATATTAATAATACCATCAATA
A
G
A
T
T
A
A
T
A
A
T
A
A
T
A
T
T
A
A
T
A
A
T
A
C
C
A
T
C
A
A
T
A
Genes: 8FCCCFCC57C

Composition

Schnauzer
55%
Yorkshire Terrier
18%
Golder Retriever
9%
Labrador
9%
German Shepard
9%

Current Energy

Vitality -57 points
Lunar Effect +14 points

Traits Breakdown

Body Golder Retriever
Tail Yorkshire Terrier
Legs Schnauzer
Front Legs Schnauzer
Head Schnauzer
Ears Yorkshire Terrier
Snout Schnauzer
Mouth Schnauzer
Nose Labrador
Eyes German Shepard
Color Schnauzer